Mini Review / Open Access

DOI: 10.31488/bjcr.1000103

Polymorphisms of XRCC1 AND XRCC3 Repair Genes and the Risk of Gastric Cancer in the Amazon Region –Brazil

Artemis Socorro do N. Rodrigues*1, Gabriel Espíndola1, Tainá Vanzeler1, Lorrayne Lacerda1, Suzane Cabral1, Olavo Picanco Jr1.

Laboratory of Molecular Biology of the Federal University of Amapá-UNIFAP, Biological Sciences Course Macapá, Amapá, Brazil

Corresponding author: Dr. Artemis Socorro do Nascimento Rodrigues, Laboratory of Molecular Biology of the Federal University of Amapá-UNIFAP, Biological Sciences Course Macapá, Amapá, Brazil, Tel: 559633121767;

Abstract

Objectives: Cancer is a genetic disease characterized by an imbalance between cell growth and regulatory factors. The genes XRCC1 and XRCC3 encode a protein that contributes to the integrity of the genome. Our study was aimed at evaluating XRCC1 Arg399Gln and XRCC3 Thr241Met polymorphisms in a sample of gastric cancer patients in the city of Macapá, Amapá, Brazil. Methodology: We analyzed 160 DNA samples (60 patients and 100 control samples). DNA samples were amplified and analyzed by PCR-RFLP with the restriction enzymes MspI and NlaIII. Results: the molecular analysis revealed that 41,6% and 63,8% of the patients samples had the Arg399Gln and Thr241Met genotypes. Conclusion: Our findings revealed that most samples of gastric cancer patients analyzed exhibited XRCC1 Arg399Gln and XRCC3 Thr241Met polymorphisms. Our goal is to apply these and future results to assist in the treatment of patients, since exposure to environmental factors as well as genetic alterations in other genes, acting alone or interacting with each other, may increase the risk of developing gastric cancer.

Keywords: gastric cancer; XRCC1 gene; XRCC3 gene; Macapá, Brazil

Introduction

The human XRCC1 gene is located in the chromosome 19q13.2, consists of 17 exons, and encodes the nuclear protein XRCC1. This protein is composed of 633 amino acids and is involved in base excision repair (BER). In this process, damaged DNA is identified and removed, including oxidized, desaminated or alkylated bases that may be produced spontaneously in the cell or as a result of exposure to exogenous agents such as radiation and UV light [1].

XRCC3 is considered to be one of the most important DNA repair genes. It consists of 7 exons located at 14q32.3 in the human chromosome and encodes a 346-amino acid protein of the same name. This protein, when interacting with Rad51, acts on the repair of double-stranded breaks (DSBs) by homologous recombination (HR), and can also participate in late recombination events, aiding the stabilization of the nucleoprotein complex and the formation of heteroduplex DNA [1-6].

Gastric cancer, despite a decreasing incidence since the 1950s, is still the fourth most common malignant neoplasm and the second largest cause of cancer death worldwide, as survival rates have not changed significantly in the last decades due to the high lethality of the disease [7-9]. The incidence of gastric cancer is higher in developing countries in people over 50 years of age, and men outnumber women by a ratio of 2 to 1. Despite declining rates in Brazil, gastric cancer still remains a disease of high mortality compared to other countries with the same epidemiological profile.

Given the high incidence rates of gastric cancer and mortality in Brazil, especially in the northern region of the country, the present study was aimed at analyzing the relationship of the XRCC1 Arg399Gln and XRCC3 Thr241Met polymorphisms in patients diagnosed with gastric cancer in the city of Macapá, in the Amazon region, northern Brazil.

Material and Methods

The case-control study was carried out in the city of Macapá, state of Amapá, Brazil. The total population consisted of 160 DNA samples, of which 100 were healthy individuals (controls) and 60 of patients diagnosed with gastric cancer and treated at the High Complexity Oncology Unit (Unidade de Alta Complexidade em Oncologia – UNACON) of Dr. Alberto Lima Clinical Hospital and the Institute of Hematology and Hemotherapy of Amapá (HEMOAP). The study was approved by the Research Ethics Committee (REC) of the Federal University of Amapá (UNIFAP) and was carried out in accordance with the Helsinki Principle Declaration. All individuals signed the Informed Consent Form (ICF).

Genotyping

DNA was isolated according to the manufacturer’s instructions (Invitrogen). Samples were amplified and analyzed by PCR-RFLP. The amplification reaction of the Polymerase Chain Reaction (PCR) of the XRCC3 gene followed Shen. et.al [4] and Cabral et al. [10]. The primers used to amplify the 208 bp fragment were 241F: 5-GCTGTCTCGGGGCATGGCTC-3 and 241R: 5 ACGAGCTCAGGGGTGCAACC-3 and the enzyme Nla III (New England Biolabs, Beverly, MA) was used. The identification of the XRCC1 polymorphism was carried out according to Vieira, (2010) and Rodrigues, et. to (2015). The primers used to identify the 615pb fragment were 399F 5’TTGTGCTTTCTCTGTGTCCA3′ and 399R 5’TCCTCCAGCCTTTTCTGATA 3′, and the restriction enzyme was Msp I. The amplified fragments were visualized by 2% agarose gel electrophoresis. The digestion of products followed the recommendation of the manufacturer of each enzyme.

Statistical Analysis

The comparison between genotype frequencies of the control and patients samples was performed using the statistical software Bio Estat 5.3 (Ayres, M. Pará, Brazil). where the was used the Fisher exact test and odds ratios (OR) with a 95% confidence interval (CI) were calculated.

Results and Discussion

The present study investigated the association between XRCC1 Arg399Gln and XRCC3 Thr241Met polymorphisms and gastric cancer in the city of Macapá, northern Brazil. Gastric cancer is the third most frequent type of cancer in the city of Macapá, the second most frequent in men, after prostate cancer, in Northern and Northeastern Brazil, and the fourth most frequent in these regions in women [11-14]. According to the Mortality Information System (MIS), the number of deaths reported in 2013 was 14,182, of which 9,142 were men and 5,040, women [12]. Table 1 and 2 shows our results.

Table 1. Frequency of XRCC1 Arg399Gln and XRCC3 Thr241Met polymorphisms in the patients and controls samples

Gastric cancer patients (n=60) Control group (n=100)
Gene with SNP % Without SNP % with SNP % Without SNP % p-value
XRCC1 25 41,6 35 58,3XRCC3 38 63,3 22 36,6 30 30 70 70 0.182810 10 90 90 0.0001

Table 2. Genotype frequency of XRCC1 and XRCC3 gene polymorphisms in the patients and controls

Genotypes Patients % Control % OR (CI 95%)
XRCC1(G399A)
Arg/Arg 35 583 70 70 Reference
Arg/Gln 25 41,6 29 29 1.7241(0.8810-3.3741) p=0.1544
Arg/Gln 0 0 1 1 –
XRCC3(C241T)
Thr/Thr 22 36,6 83 83 Reference
Thr/Met 35 58,3 7 7 18.8636(7.3849-48.18433) p = 0.0001
Met/Met 3 5 3 3 3.7727(0.7117-19.9998) p=0.2484

Our results demonstrate that of the 60 samples of patients diagnosed with gastric cancer, 25 (41,6%) and 38 (63,8%) exhibited Arg399Gln and Thr241Met polymorphisms, respectively. Several studies have described the association of these two polymorphisms with malignant neoplasms [10,15,16].

Studies on these polymorphisms in specific populations are needed due to wide regional differences regarding the risk of developing cancer. Our research group previously found strong evidence that they may be associated with gastric cancer in this population [10, 15,16].

Our results revealed that 58,3% of patients had the Thr/Met genotype, and 41,6% the Arg/Gln genotype. Our results confirm the involvement of these polymorphisms with this malignant disease [10,15,16].

Our findings support other studies already conducted on the association between XRCC3 polymorphism and the risk of gastric cancer. Although polymorphic genotype was found at a high frequency in the patients examined, further molecular studies are needed on the Thr241Met genotype and the risk of developing gastric cancer in this and other populations for greater reliability between the association of this polymorphism and the risk of gastric cancer.

Our results show that probably people with the Arg/Gln genotype show greater susceptibility to the development of some form of cancer. Thus, we can also consider the 399Gln polymorphism a possible genetic marker for use in cancer prognosis, yet it is undoubtedly necessary to increase the number of cases and controls.

Given that gastric cancer is the third most frequent type in the state of Amapá (INCA, 2016), studies examining the association between molecular alterations and this disease may assist the description of the clinical picture of patients and the correct treatment. Our study demonstrated that most gastric cancer patient samples analyzed exhibited XRCC1 Arg399Gln and XRCC3 Thr241Met polymorphisms. Because of the small sample size, additional data are being gathered. Despite that, our findings revealed an early association between polymorphisms and gastric cancer in the study population.

Our goal is to apply these and additional results in the future and thus to benefit and assist in the treatment of each patient, since environmental factors of exposure as well as genetic alterations in other genes acting alone or interacting with each other may increase the risk of developing gastric cancer.

Consent

The author declare that written informed consent was obtained from all the patient.

Ethical Approval

The author hereby declare that all experiments have been examined and approved by the appropriate ethics committee and have therefore been performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki.

Survival Outcomes after Radical Prostatectomy

Arguments exist on both sides of the debate regarding the equivalence of survival outcomes following RP in African-American men. Reports increasingly affirm that if localized prostate cancer is treated adequately and appropriately across all grades and stages survival outcomes are equivalent across racial groups [46-48]. Adding to this sense of optimism is the observation by some investigators that with respect to the utilization of RP trends are occurring toward improved availability and efficiency of this treatment across racial groups [49,50]. However, it is noteworthy that one such study in this camp identified a compensatory basis for the observed similarities in prostate cancer severity at presentation in their cohort: African-American men presented at younger ages than their counterparts with similar stage and grade cancers [46]. This remark importantly acknowledges that high-risk tumor biology persists as a fundamental disease risk differentiator in the African-American population.

Opposing reports assess non-equivalence of survival outcomes after RP: African-American men display significantly shorter overall and cancer-specific survival times, regardless of treatment for localized disease and after adjustment for multiple covariates including age, comorbidity score, stage and grade of prostate cancer, treatment site, and proxies for socioeconomic status [51,52]. Investigators from this camp explain the poorer disease control in their cohorts as reflecting the possibilities of technically inadequate treatment or tumors with more aggressive biological behavior that account for racial differences.

Synthesis

Although the subject of utilization and outcomes of RP for clinically localized prostate cancer in African-Americans is contentious, an overarching supposition is that racial variations in this arena likely exist. A host of factors are known to be at play and exert roles of variable extent. Viewpoints may differ as to the impact of RP on survival outcomes, as discussed, despite the rigor of exercises on both sides that have controlled for race-non-specific risk factors. In the context of patterns of care, treatment access is a central differentiator in the debate, and although it is likely a major basis for underutilization of RP by African-Americans principally this matter presumably differs from a race-specific variable. Tumor biology constitutes a likely race-specific risk determinant, and further investigation in the field may yield a calculation of its magnitude in causing racial variations. Quality of care when utilizing RP (e.g., provider’s qualifications and experience) also warrants consideration as a possible contributing factor leading to putative survival outcome differences across racial groups, and healthcare researchers are increasingly striving to understand and weigh the extent of RP quality indicators in this overall appraisal [24,53,54].

Take-Action Considerations

Assuming the likelihood of racial variation in the surgical care for prostate cancer, steps can be taken to eradicate this disparity. Precisely, both pattern of care and quality of care improvements should be sought and are consistent with clarion calls for policy change in prostate cancer management from such institutions as the Institute of Medicine [14,15].

Pattern of care improvements refers to such opportunities as enhancing early detection, diagnosis and treatment of prostate cancer and enabling access to prostate cancer healthcare and health insurance. The increased utilization of PSA testing in minority populations over recent eras of its use, for instance, has been shown to lessen the racial gap in the delivery and outcomes of treatment for prostate cancer [51]. This assessment adds mightily to the counterargument against current recommendations for disbanding PSA testing for prostate cancer screening [8].

Quality of care improvements refers to such opportunities of bringing and adhering to quality indicators of healthcare across structure, process and outcome domains within the arena of prostate cancer management [24,53,54].

Besides these healthcare programmatic initiatives, ongoing activities to study risk factors for racial disparities across biological, genetic, social, environmental, dietary, and lifestyle domains can be expected to be gainful. Such efforts would in turn foster the development of disease risk biomarkers, diagnostic and therapeutic technologies and other innovations that may be introduced to the surgical arena of prostate cancer in hopes of reducing racial disparities of this disease.

Reference

  1. American Cancer Society.
  2. Surveillance, Epidemiology, End Results.
  3. Siegel R, Naishadham D, Jemal A. Cancer statistics. CA Cancer J Clin. 2012; 62:10-29.
  4. Robbins AS, Yin D, Parikh-Patel A. Differences in prognostic factors and survival among white men and black men with prostate cancer, California, 1995-2004. Am J Epidemiol. 2007; 166:71-8.
  5. Cooperberg, MR, Broering JM, Litwin MS, et al. The contemporary management of prostate cancer in the United States: lessons from the cancer of the prostate strategic urologic research endeavor (CapSURE), a national disease registry. J Urol. 2004; 171:1393-401.
  6. Siegel R, DeSantis C, Virgo K, et al. Cancer treatment and survivorship statistics, 2012. CA Cancer J Clinic. 2012; 62:220-41.
  7. Espey DK, Wu XC, Swan J, et al. Annual report to the nation on the status of cancer, 1975-2004, featuring cancer in American Indians and Alaska Natives. Cancer. 2007; 110:2119-52.
  8. Lin K, Croswell JM, Koenig H, et al. Prostate-specific antigen-based screening for prostate cancer: an evidence update for the U.S. preventive services task force [Internet]. Rockville (MD): Agency for Healthcare Research and Quality (US) 2011; Report NO: 12-05160-EF-1.
  9. Ellison LM, Heaney JA, Birkmeyer JD. Trends in the use of radical prostatectomy for treatment of prostate cancer. Eff Clin Pract. 1999; 2:228-33.
  10. Mullins JK, Feng Z, Trock BJ, et al. The impact of anatomical radical retropubic prostatectomy on cancer control: the 30-year anniversary. J Urol. 2012; 188:2219-24.
  11. Morris CR, Snipes KP, Schlag R, et al. Sociodemographic factors associated with prostatectomy utilization and concordance with the physician data query for prostate cancer (United States). Cancer Causes Control. 1999; 10:503 – 11.
  12. Harlan L, Brawley O, Pommerenke F, et al. Geographic, age, and racial variation in the treatment of local/regional carcinoma of the prostate. J Clin Oncol. 1995; 13: 93-100.
  13. Schapira MM, McAuliffe TL, Nattinger AB. Treatment of localized prostate cancer in African-American compared with Caucasian men. Less use of aggressive therapy for comparable disease. Med Care. 1995; 33:1079-88.
  14. Freund KM, Battaglia TA, Calhoun E, et al. National Cancer Institute Patient Navigation Research Program: methods, protocol and measures. Cancer. 2008; 113: 3391-9.
  15. Vicini FA, Shah C, Wallace M, et al. Strategies for reducing cancer incidence and mortality in African American and Arab American and Chaldean communities in the Detroit metropolitan area. Am J Clin Oncol. 2012; 35:316-21.
  16. Tehranifar P, Neugut AI, Phelan JC, et al. Medical advances and racial/ethnic disparities in cancer survival. Cancer Epidemiol Biomarkers Prev. 2009; 18:2701-8.
  17. DeLancey JO, Thun MJ, Jemal A, et al. Recent trends in black-white disparities in cancer mortality. Cancer Epidemiol Biomarkers Prev. 2008; 17:2908-12.
  18. Hoffman RM, Gilliland FD, Eley JW, et al. Racial and ethnic differences in advanced-stage prostate cancer: the Prostate Cancer Outcomes Study. J Natl Cancer Inst. 2001; 93:388-95.
  19. Thompson I, Tangen C, Tolcher A, et al. Association of African-American ethnic background with survival in men with metastatic prostate cancer. J Natl Cancer Inst. 2001; 93:219-25.
  20. Latini DM, Elkin EP, Cooperberg MR, et al. Differences in clinical characteristics and disease-free survival for Latino, African American, and non-Latino white men with localized prostate cancer: data from CaPSURE. Cancer. 2006; 106:789-95.
  21. Albain KS, Unger JM, Crowley JJ, et al. Racial disparities in cancer survival among randomized clinical trials patients of the Southwest Oncology Group. J Natl Cancer Inst. 2009; 101:984-92.
  22. Zeliadt SB, Ramsey SD, Penson DF, et al. Why do men choose one treatment over another?: a review of patient decision making for localized prostate cancer. Cancer. 2006; 106:1865-74.
  23. Zeliadt SB, Potosky AL, Etzioni R, et al. Racial disparity in primary and adjuvant treatment for nonmetastatic prostate cancer: SEER-Medicare trends 1991 to 1999. Urology. 2004; 64:1171-6.
  24. Barocas DA, Penson DF. Racial variation in the pattern and quality of care for prostate cancer in the USA: mind the gap. BJU Int. 2010; 106:322-8.
  25. Du XL, Lin CC, Johnson NJ, et al. Effects of individual-level socioeconomic factors on racial disparities in cancer treatment and survival: findings from the National Longitudinal Mortality Study, 1979-2003. Cancer. 2011; 117:3242-51.
  26. Platz EA, Rimm EB, Willett WC, et al. Racial variation in prostate cancer incidence and in hormonal system markers among male health professionals. J Natl Cancer Inst. 2000; 92:2009-17.
  27. Pettaway CA. Racial differences in the androgen/androgen receptor pathway in prostate cancer. J Natl Med Assoc. 1999; 91:653-60.
  28. Harlan LC, Potosky A, Gilliland FD, et al. Factors associated with initial therapy for clinically localized prostate cancer: prostate cancer outcomes study. J Natl Cancer Inst. 2001; 93:1864-71.
  29. Shavers VL, Brown M, Klabunde CN, et al. Race/ethnicity and the intensity of medical monitoring under ‘watchful waiting’ for prostate cancer. Med Care. 2004; 42:239-50.
  30. Rim SH, Hall IJ, Fairweather ME, et al. Considering racial and ethnic preferences in communication and interactions among the patient, family member, and physician following diagnosis of localized prostate cancer: study of a US population. Int J Gen Med. 2011; 4:481-6.
  31. Pollack CE, Bekelman JE, Epstein AJ, et al. Racial disparities in changing to a high-volume urologist among men with localized prostate cancer. Med Care. 2011; 49:999-1006.
  32. Miller DC, Litwin MS, Bergman J, et al. Prostate cancer severity among low income, uninsured men. J Urol. 2009; 181: 579-83.
  33. Powell IJ, Schwartz K, Hussain M. Removal of the financial barrier to health care: does it impact on prostate cancer at presentation and survival? A comparative study between black and white men in a Veterans Affairs system. Urology. 1995; 46:825-30.
  34. Parsons JK, Kwan L, Connor SE. et al. Prostate cancer treatment for economically disadvantaged men: a comparison of county hospitals and private providers. Cancer. 2010; 116:1378-84.
  35. Merrill RM, Lyon JL. Explaining the difference in prostate cancer mortality rates between white and black men in the United States. Urology. 2000; 55:730-5.
  36. Evans S, Metcalfe C, Ibrahim F, et al. Investigating black-white differences in prostate cancer prognosis: A systematic review and meta-analysis. Int J Cancer. 2008; 123:430-5.
  37. Bradley CJ, Given CW, Roberts C. Race, socioeconomic status, and breast cancer treatment and survival. J Natl Cancer Inst. 2002; 94:490-6.
  38. Newman LA, Griffith KA, Jatoi I, et al. Meta-analysis of survival in African American and White American patients with breast cancer: ethnicity compared with socioeconomic status. J Clin Oncol. 2006; 24:1342-9.
  39. Du XL, Meyer TE, Franzini L. Meta-analysis of racial disparities in survival in association with socioeconomic status among men and women with colon cancer. Cancer. 2007; 109:2161-70.
  40. Bach PB, Schrag D, Brawley OW, et al. Survival of blacks and whites after a cancer diagnosis. JAMA. 2002; 287:2106-13.
  41. Pienta KJ, Demers R, Hoff M, et al. Effect of age and race on the survival of men with prostate cancer in the metropolitan Detroit tricounty area, 1973-1987. Urology. 1995; 45:93-101.
  42. Moul JW, Douglas TH, McCarthy WF, et al. Black race is an adverse prognostic factor for prostate cancer recurrence following radical prostatectomy in an equal access health care setting. J Urol. 1996; 155: 1667-73.
  43. Powell IJ, Banerjee M, Novallo M, et al. Prostate cancer biochemical recurrence stage for stage is more frequent among African-American than white men with locally advanced but not organ-confined disease. Urology. 2000; 55:246-51.
  44. Tarman GJ, Kane CJ, Moul JW, et al. Impact of socioeconomic status and race on clinical parameters of patients undergoing radical prostatectomy in an equal access health care system. Urology. 2000; 56:1016-20.
  45. Freedland SJ, Jalkut M, Dorey F, et al. Race is not an independent predictor of biochemical recurrence after radical prostatectomy in an equal access medical center. Urology. 2000; 56:87-91.
  46. Underwood W 3rd, Wei J, Rubin MA, et al. Postprostatectomy cancer-free survival of African Americans is similar to non-African Americans after adjustment for baseline cancer severity. Urol Oncol. 2004; 22:20-4.
  47. Resnick MJ, Canter DJ, Guzzo TJ, et al. Does race affect postoperative outcomes in patients with low-risk prostate cancer who undergo radical prostatectomy? Urology. 2009; 73:620-3.
  48. Klein JB, Nguyen CT, Saffore L, et al. Racial disparities in urologic health care. J Natl Med Assoc. 2010; 102:108-17.
  49. Bañez LL, Terris MK, Aronson WJ, et al. Race and time from diagnosis to radical prostatectomy: does equal access mean equal timely access to the operating room?—Results from the SEARCH database. Cancer Epidemiol Biomarkers Prev. 2009; 18:1208-12.
  50. Trinh QD, Schmitges J, Sun M, et al. Improvement of racial disparities with respect to the utilization of minimally invasive radical prostatectomy in the United States. Cancer. 2012; 118:1894-900.
  51. Godley PA, Schenck AP, Amamoo MA, et al. Racial differences in mortality among Medicare recipients after treatment for localized prostate cancer. J Natl Cancer Inst. 2003; 95:1702-10.
  52. Cohen JH, Schoenbach VJ, Kaufman JS, et al. Racial differences in clinical progression among Medicare recipients after treatment for localized prostate cancer (United States). Cancer Causes Control. 2006; 17:803-11.
  53. Spencer BA, Miller DC, Litwin MS, et al. Variations in quality of care for men with early-stage prostate cancer. J Clin Oncol. 2008; 26: 3735-42.
  54. Miller DC, Saigal CS. Quality of care indicators for prostate cancer: progress toward consensus. Urol Oncol. 2009; 27:427-34.

Received: April 24, 2018;
Accepted: May 3, 2018;
Published: May 5, 2018.

To cite this article : Burnett AL. Eradicating Prostate Cancer Disparities in the Surgical Care for Prostate Cancer.

British Journal of Cancer Research. 2018: 1:1.

© Burnett AL, et al. 2018.